90
|
Qiagen
forward and reverse primers Forward And Reverse Primers, supplied by Qiagen, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/forward and reverse primers/product/Qiagen Average 90 stars, based on 1 article reviews
forward and reverse primers - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
90
|
Biomics Biotechnologies
forward and reverse primers Forward And Reverse Primers, supplied by Biomics Biotechnologies, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/forward and reverse primers/product/Biomics Biotechnologies Average 90 stars, based on 1 article reviews
forward and reverse primers - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
90
|
Midland Certified Reagent
forward and reverse primers Forward And Reverse Primers, supplied by Midland Certified Reagent, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/forward and reverse primers/product/Midland Certified Reagent Average 90 stars, based on 1 article reviews
forward and reverse primers - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
90
|
GeneWorks
forward and reverse primers Forward And Reverse Primers, supplied by GeneWorks, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/forward and reverse primers/product/GeneWorks Average 90 stars, based on 1 article reviews
forward and reverse primers - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
90
|
Eurofins Genomics
primer: thrap3_i2 reverse: caagcagaagacggcatacgagatacatcg attggcctggttcggtcttctc Primer: Thrap3 I2 Reverse: Caagcagaagacggcatacgagatacatcg Attggcctggttcggtcttctc, supplied by Eurofins Genomics, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/primer: thrap3_i2 reverse: caagcagaagacggcatacgagatacatcg attggcctggttcggtcttctc/product/Eurofins Genomics Average 90 stars, based on 1 article reviews
primer: thrap3_i2 reverse: caagcagaagacggcatacgagatacatcg attggcctggttcggtcttctc - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
90
|
Pacific Biosciences
the primer pair encodes forward and reverse barcodes for amplicon sequencing The Primer Pair Encodes Forward And Reverse Barcodes For Amplicon Sequencing, supplied by Pacific Biosciences, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/the primer pair encodes forward and reverse barcodes for amplicon sequencing/product/Pacific Biosciences Average 90 stars, based on 1 article reviews
the primer pair encodes forward and reverse barcodes for amplicon sequencing - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
90
|
Metabion International AG
mouse primers Mouse Primers, supplied by Metabion International AG, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/mouse primers/product/Metabion International AG Average 90 stars, based on 1 article reviews
mouse primers - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
90
|
Biolegio bv
barcoded forward primer and reverse primer mix biolegio bv Barcoded Forward Primer And Reverse Primer Mix Biolegio Bv, supplied by Biolegio bv, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/barcoded forward primer and reverse primer mix biolegio bv/product/Biolegio bv Average 90 stars, based on 1 article reviews
barcoded forward primer and reverse primer mix biolegio bv - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
90
|
Microsynth ag
labelled forward primers Labelled Forward Primers, supplied by Microsynth ag, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/labelled forward primers/product/Microsynth ag Average 90 stars, based on 1 article reviews
labelled forward primers - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
90
|
Mobix Inc
300 nm each forward and reverse bdnf primers 300 Nm Each Forward And Reverse Bdnf Primers, supplied by Mobix Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/300 nm each forward and reverse bdnf primers/product/Mobix Inc Average 90 stars, based on 1 article reviews
300 nm each forward and reverse bdnf primers - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
90
|
Qiagen
il28b forward and reverse primers Il28b Forward And Reverse Primers, supplied by Qiagen, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/il28b forward and reverse primers/product/Qiagen Average 90 stars, based on 1 article reviews
il28b forward and reverse primers - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
90
|
Macrogen
forward and reverse primers ( each, macrogen) Forward And Reverse Primers ( Each, Macrogen), supplied by Macrogen, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/forward and reverse primers ( each, macrogen)/product/Macrogen Average 90 stars, based on 1 article reviews
forward and reverse primers ( each, macrogen) - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |